bkdR [2019-02-19 19:13:36]

transcriptional activator of the ptb-bcd-buk-lpdV-bkdAA-bkdAB-bkdB operon

Locus: BSU24100

Isoelectric point: 6.24

Molecular weight: 77.75 kDa

Protein length: 692 aa

Gene length: 2079 bp

Function: regulation of branched-chain amino acid utilization

Product: transcriptional activator (for SigL-dependent promoter)

Essential: no

Synonyms: yqiR

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Amino acid/ nitrogen metabolism → Utilization of amino acids → Utilization of branched-chain amino acids
• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other

Gene

Coordinates: 2,504,789 2,506,867

Phenotypes of a mutant

• cold-sensitive PubMed

The protein

Protein family

• Transcription factors activating transcription at SigL-dependent promoters

Domains

• two PAS domains (aa 115 ... 185, aa 234 ... 305) (according to UniProt)
• C-terminal domain for interaction with SigL (aa 368 ... 598) (according to UniProt)

Structure

• 1OJL (ZraR from Salmonella typhimurium, C-terminal interaction domain, corresponds to aa 368 ... 683 of BkdR, 41% identity) PubMed

Expression and Regulation

Operons

• Genes: bkdR
  Description: PubMed

  Regulatory mechanism

  • CodY: repression, PubMed, in CodY regulon

  Regulation

  • repressed during growth in the presence of branched chain amino acids (CodY) PubMed

Biological materials

Mutant

• MGNA-C375 (yqiR::erm), available at the NBRP B. subtilis, Japan
• 1A913 ( bkdR::kan), PubMed, available at BGSC and in Jrg Stlke's lab
• BKE24100 (bkdR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCCCGATACCCCTTTGTA, downstream forward: _UP4_TAATTTGCAGAATAAACGCA
• BKK24100 (bkdR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCCCGATACCCCTTTGTA, downstream forward: _UP4_TAATTTGCAGAATAAACGCA

References

Loading